| 產品名稱 | Candida parapsilosis (Ashford) Langeron et Talice |
|---|---|
| 商品貨號 | B166144 |
| Strain Designations | CBS 604 [CCRC 20515, DBVPG 6150, DMS 5784, IBL 2545, IFO 1396, IGC 2545, JCM 1785, NBRC 1396, NCYC 601, NRRL Y-12969, UCD 61-27] |
| Application | Assay of itraconzaole
Assay of ketoconazole
Control strain for identification
Degrades hydroxybenzoate
Degrades phenol
Produces (S)-1,3-butanediol dehydrogenase
Produces lipase
Quality control
Quality control strain
Susceptibility disc testing
Susceptibility testing
Antifungal susceptibility testing Ref
  Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. RefEspinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.Reference strain for Clinical and Laboratory Standards Institute(CLSI)-developed Antifungal Susceptibility Testing |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | yes |
| Preceptrol® | yes |
| Comments | Esterase activity Electrophoretic karyotype RAPD profiles
This organism is a CLSI control strain for antimicrobial susceptibility testing. |
| Medium | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 325: Malt extract agar (Blakeslee's formula) ATCC® Medium 28: Emmons' modification of Sabouraud's agar |
| Growth Conditions | Temperature: 30°C to 35°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTGAACCTGCGGAAGGATCATTACAGAATGAAAAGTGCTTAACTGCATTTTTTCTTACACATGTGTTTTTCTTTTTTTGAAAACTTTGCTTTGGTAGGCCTTCTATATGGGGCCTGCCAGAGATTAAACTCAACCAAATTTTATTTAATGTCAACCGATTATTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCTCGGGTTTGGTGTTGAGCGATACGCTGGGTTTGCTTGAAAGAAAGGCGGAGTATAAACTAATGGATAGGTTTTTTCCACTCATTGGTACAAACTCCAAAACTTCTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA D1D2 region of the 26S ribosomal RNA gene CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGATAAGTGCAAAGAAATGTGGCACTGCTTCGGTAGTGTGTTATAGTCTTTGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTGGCATAATGATCTTAAGTCG |
| Name of Depositor | CBS |
| Chain of Custody | ATCC <-- CBS <-- BK Ashford |
| Isolation | Case of sprue, Puerto Rico |
| Cross References | Nucleotide (GenBank) : KU729052 ITS including 5.8S rRNA gene Nucleotide (GenBank) : M60307 small subunit ribosomal RNA Nucleotide (GenBank) : L11352 5.8S ribosomal RNA gene, sequence Nucleotide (GenBank) : U45754 26S ribosomal RNA gene, partial sequence Nucleotide (GenBank) : U46004 Candida parapsilosis ribosomal RNA large subunit gene sequence. Nucleotide (GenBank) : U10987 5.8S rRNA gene and internal transcribed spacers 1 and 2, complete sequence Nucleotide (GenBank) : AF085429 ADP/ATP carrier protein gene, nuclear gene encoding mitochondrial protein, complete coding sequence |
| References | Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150 Ashford BK. Certain conditions of the gastro-intestinal tract in Porto Rico and their relation to tropical sprue. Am. J. Trop. Med. Hyg. 8: 507-538, 1928. Lott TJ, et al. Genomic heterogeneity in the yeast Candida parapsilosis. Curr. Genet. 23: 463-467, 1993. PubMed: 8319303 Briand D, et al. Functioning and regioselectivity of the lipase of Candida parapsilosis (Ashford) Langeron and Talice in aqueous medium. New interpretation of regioselectivity taking acyl migration into account. Eur. J. Biochem. 228: 169-175, 1995. PubMed: 7883000 Zeng S, et al. Random amplified polymorphic DNA analysis of culture collection strains of Candida species. J Med Vet Mycol 34: 293-297, 1996. PubMed: 8873891 Lott TJ, et al. Nucleotide sequence analysis of the 5-8S rDNA and adjacent ITS2 region of Candida albicans and related species. Yeast 9: 1199-1206, 1993. PubMed: 8109169 Vazquez JA, et al. Comparison of restriction enzyme analysis versus pulsed-field gradient gel electrophoresis as a typing system for Torulopsis glabrata and Candida species other than C. albicans. J Clin Microbiol 31: 2021-2030, 1993. PubMed: 8396585 Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J Clin Microbiol 32: 1625-1628, 1994. PubMed: 7929747 Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J Clin Microbiol 32: 1650-1653, 1994. PubMed: 7929752 Lin D, et al. Three distinct genotypes within Candida parapsilosis from clinical sources. J. Clin. Microbiol. 33: 1815-1821, 1995. PubMed: 7665651 Yamamoto H, et al. Purification and characterization of (S)-1,3-butanediol dehydrogenase from Candida parapsilosis. Biosci. Biotechnol. Biochem. 59: 1769-1770, 1995. PubMed: 8520120 Briand D, et al. Factors affecting the acyltransfer activity of the lipase from Candida parapsilosis in aqueous media. J. Am. Oil Chem. Soc. 72: 1367-1373, 1995. Rex JH, et al. Quality control guidelines for National Committee for Clinical Laboratory Standards--recommended broth macrodilution testing of ketoconazole and itraconazole. J. Clin. Microbiol. 34: 816-817, 1996. PubMed: 8815089 Nebohacova M, et al. Isolation and expression of the gene encoding mitochondrial ADP/ATP carrier (AAC) from the pathogenic yeast Candida parapsilosis. Yeast 15: 1237-1242, 1999. PubMed: 10487926 Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410 Barns SM, et al. Evolutionary relationships among pathogenic Candida species and relatives. J. Bacteriol. 173: 2250-2255, 1991. PubMed: 2007550 Middelhoven WJ, et al. Degradation of some phenols and hydroxybenzoates by the imperfect ascomycetous yeasts Candida parapsilosis and Arxula adeninivorans: evidence for an operative gentisate pathway. Antonie van Leeuwenhoek 62: 181-187, 1992. PubMed: 1416914 Sensititre™ YeastOne. Thermo Scientific™ Sensititre™ Systems, Trek Diagnostic Systems. Quality Control MIC Limits for Broth Microdilution Informational Supplement. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M27-S3. Method for Antifungal Disk Diffusion Susceptibility Testing of Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M44-A2. Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002 VITEK 2 Antifungal AST Card. bioMerieux. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2. VITEK 2 AST-YS QC Set. bioMerieux. Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005. Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. Abi-Chacra EA, et al. Phenotypical properties associated with virulence from clinical isolates belonging to the Candida parapsilosis complex. FEMS Yeast Res. 13: 831-848, 2013. PubMed: 24103069 Bisha B, Kim HJ, Brehm-Stecher BF. Improved DNA-FISH for cytometric detection of Candida spp. J Appl Microbiol 110: 881-892, 2011. PubMed: 21205104 Cornet M, et al. Molecular identification of closely related Candida species using two ribosomal intergenic spacer fingerprinting methods. J Mol Diagn 13: 12-22, 2011. PubMed: 21227390 Gunisova S, et al. Identification and comparative analysis of telomerase RNAs from Candida species reveal conservation of functional elements. RNA 15: 546-559, 2009. PubMed: 19223441 Borman AM, et al. Candida nivariensis, an emerging pathogenic fungus with multidrug resistance to antifungal agents. J. Clin. Microbiol. 46: 933-938, 2008. PubMed: 18199788 Kosa P, Gavenciakova B, Nosek J. Development of a set of plasmid vectors for genetic manipulations of the pathogenic yeast Candida parapsilosis. Gene 396: 338-345, 2007. PubMed: 17512139 Innings A, et al. Multiplex real-time PCR targeting the RNase P RNA gene for detection and identification of Candida species in blood. J Clin Microbiol 45: 874-880, 2007. PubMed: 17215340 Kosa P, et al. Complete DNA sequences of the mitochondrial genomes of the pathogenic yeasts Candida orthopsilosis and Candida metapsilosis: insight into the evolution of linear DNA genomes from mitochondrial telomere mutants. Nucleic Acids Res. 34: 2472-2481, 2006. PubMed: 16684995 |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |
