| 產品名稱 |
Monascus purpureus Went |
| 商品貨號 |
B167040 |
| Deposited As |
Monascus purpureus Went |
| Strain Designations |
CBS 109.07 [ATCC 16426, IFO 4513, IMI 210765, NRRL 1596] |
| Application |
produces citrinin antimycin produces red pigment |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
frozen |
| Storage Conditions |
Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section |
| Type Strain |
yes |
| Disclosure |
This material is cited in a US or other Patent and may not be used to
infringe the claims. Depending on the wishes of the Depositor, ATCC may be
required to inform the Patent Depositor of the party to which the material was
furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol® |
no |
| Comments |
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA) |
| Medium |
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
ATCC® Medium 336: Potato dextrose agar (PDA)
|
| Growth Conditions |
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
AAGGATCATTACCGAGTGCGGGTCCCCTTCGTGGGACCCAACCTCCCACCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCCGCCGGAGACATCTTCTCGAACGCTGTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAACGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
D1D2 region of the 28S ribosomal RNA gene
CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTCCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGCTCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCGGAGAGGGTGAGAATCCCGTCTGGGACGGGGTGCCTGGGTCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGATCAGACTCGCCTGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTCGGGTGGCCGGTCAAAGGCCCCGGGAATGTGTCGCCCTCCGGGGCGTCTTATAGCCCGGGGTGCCATGCGGCCTACCTGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAGCGA
|
| Name of Depositor |
CBS |
| U.S. Patent Number |
|
| Chain of Custody |
ATCC <-- CBS <-- F Went |
| Isolation |
Ang-quac, fermented rice grain, Java |
| Cross References |
Nucleotide (GenBank) :
M83260
Monascus purpureus 18S ribosomal RNA.
|
| References |
Shepard D, Carels MS. Red pigment production. US Patent 4,145,254 dated Mar 20 1979
Ohno S, et al. Process for the production of Monascus-pigment. US Patent 4,442,209 dated Apr 10 1984
. . Ann. Sci. Nat. Bot., 8th ser. 1: 1, 1895.
Blanc PJ, et al. Production of citrinin by various species of Monascus. Biotechnol. Lett. 17: 291-294, 1995.
|
