| 產品名稱 | Saccharomyces cerevisiae Meyen ex E.C. Hansen |
|---|---|
| 商品貨號 | B167279 |
| Deposited As | Saccharomyces cerevisiae Hansen |
| Classification | Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae |
| Strain Designations | NRRL Y-567 [CBS 2978, CBS 5900, CCY 21-4-48, CCY 21-4-54, NCTC 10716, NCTC 7239, NCYC 87, Pattee 6, PCI M-50] |
| Alternate State | Candida robusta Diddens et Lodder |
| Application | Assay of amphotericin Assay of amphotericin B fungizone Assay of anisomycin Assay of antifongine Assay of candicidin Assay of natamycin pimaricin, tennecetin Assay of nystatin fungicidin Media testing Produces arginase Produces ethyl alcohol ethanol Food testing Pharmaceutical and Personal Care Produces histone deacetylase Produces nicotinic acid niacin Sterility testing Susceptibility testing Testing disinfectants Testing fungicides Produces ethanol from saccharified whole corn mash Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM) |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Preceptrol® | yes |
| Ploidy | polyploid
Ref  Ness F, et al. Identification of yeast strains using the polymerase chain reaction. J. Sci. Food Agric. 62: 89-94, 1993. |
| Comments | Invertase activity Oligosaccharide transfer in microsomes Deoxy-trehalose synthesis |
| Morphology | On YM agar after 3 days at 25°C, colonies are cream colored, smooth, usually flat, occasionally raised in the centerpart. Older colonies may be slightly tan and opaque. Cells are ovoid, globose, budding, usually isolated or clustered, 3.0-8.0 by 5.0-10.0 μm. |
| Medium | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 1245: YEPD |
| Growth Conditions | Temperature: 30°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
TATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAA D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC |
| Name of Depositor | NRRL |
| Isolation | Distillery yeast |
| Cross References | Nucleotide (GenBank) : KU729188 D1/D2 region of 26S rRNA gene Nucleotide (GenBank) : GQ996543 ITS including 5.8S rRNA gene |
| References | Tseng MM, Phillips CR. The kinetics of yeast growth and nicotinic acid production. Biotechnol. Bioeng. 24: 1319-1325, 1982. Hagemann G, et al. Fungicidal compound and process of making same. US Patent 3,052,605 dated Sep 4 1962 British Pharmacopoeia Commission Biological assay of antibiotics. London, UK:British Pharmacopoeia Commission;British Pharmacopoeia Appendix XIV A, 2003 Ness F, et al. Identification of yeast strains using the polymerase chain reaction. J. Sci. Food Agric. 62: 89-94, 1993. Tran-Dinh S, et al. A novel approach for investigating reaction mechanisms in cells. Mechanism of deoxy-trehalose synthesis in Saccharomyces cerevisiae studied by 1H-NMR spectroscopy. Eur. J. Biochem. 228: 727-731, 1995. PubMed: 7737170 Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J Clin Microbiol 32: 1625-1628, 1994. PubMed: 7929747 Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J Clin Microbiol 32: 1650-1653, 1994. PubMed: 7929752 Chu FK, Maley F. Growth phase dependence of invertase mRNA levels in yeast. J. Biol. Chem. 255: 6387-6391, 1980. PubMed: 6993470 Trimble RB, et al. Effect of glucosylation of lipid intermediates on oligosaccharide transfer in solubilized microsomes from Saccharomyces cerevisiae. J. Biol. Chem. 255: 11892-11895, 1980. PubMed: 7002929 Sanchez del Pino MM, et al. Properties of the yeast nuclear histone deacetylase. Biochem. J. 303: 723-729, 1994. PubMed: 7980438 AOAC International Testing disinfectants against Staphylococcus aureus, hard surface carrier test method. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 991.48. European Pharmacopoeia Commission Microbiological assay of antibiotics. Strasbourg, France:European Pharmacopoeia Commission;European Pharmacopoeia EP 2.7.2, 1997 U.S. Pharmacopeia General Chapters; <81> Antibiotics-Microbial Assays. Rockville, MD: U.S. Pharmacopeia; USP USP34-NF29, 2011 AOAC International Antibiotics in feeds, microbiological methods. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 957.23. Vazquez-Torres A, et al. Peroxynitrute contributes to the candidacidal activity of nitric oxide-producing macrophages. Infect. Immun. 64: 3127-3133, 1996. PubMed: 8757843 Bowman FW. Test organisms for antibiotic microbial assays. Antibiot. Chemother. 7: 639-640, 1957. Platt TB, Itkin AG. Microbiological assay of nystatin in feeds. J. Assoc. Off. Anal. Chem. 57: 536-540, 1974. PubMed: 4833389 Chan PY, Cossins EA. Arginine metabolism in Saccharomyces cerevisiae. Some general properties of yeast arginase. Plant Cell Physiol. 14: 641-651, 1973. Ziffer J, Iosif MI. Temperature effects in ethanol fermentation high corn media. Biotechnol. Lett. 4: 809-814, 1982. Bowman FW, et al. Collaborative study of aerobic media for sterility testing by membrane filtration. J. Pharm. Sci. 60: 1087-1088, 1971. PubMed: 5000479 Microbial assay for antibiotics. Tokyo, Japan:Japanese Pharmacopoeia;JP JP14e.part I.34. Microbiology of food and animal feeding stuffs--Guidelines on preparation and production of culture media-- Part 2: Practical guidelines on performance testing of culture media.. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 11133-2:2003. Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002 Chemical disinfectants and antiseptics -- Quantitative suspension test for the evaluation of fungicidal activity of chemical disinfectants and antiseptics used in food, industrial, domestic and institutional areas -- Test method and requirements (phase 2, step 1). London, UK:British Standards Institution;British Standard BS EN 1650:1998. Chemical disinfectants and antiseptics - Preservation of test organisms used for the determination of bactericidal, sporicidal and fungicidal activity. London, UK:British Standards Institution;British Standard BS EN 12353:2006. Chemical disinfectants and antiseptics --- Quantitative non-porous surface test for the evaluation of bactericidal and/or fungicidal activity of chemical disinfectants used in food, industrial, domestic and institutional areas --- Test method and requirements without mechanical action (phase 2/step 2). London, UK:British Standards Institution;British Standard BS EN 13697:2001. Chemical disinfectants and antiseptics --- Application of European Standards for chemical disinfectants and antiseptics. London, UK:British Standards Institution;British Standard BS EN 14885:2006. Microbiology of food and animal feeding stuffs --- Guidelines on preparation and production of culture media --- Part 2: Practical guidelines on performance testing of culture media - Annex B: Recommended test microorganisms for commonly used culture media. London, UK:British Standards Institution;British Standard DD CEN ISO/TS 11133:2003. ISO/CD 11133:2009, Annex E. Test microorganisms for commonly used culture media (giving information on the culture medium, culture conditions, test microorganisms, culture collection number of test organisms and the expected reactions) Corry, JEL, Curtis, GDW and Baird, RM (Eds) Handbook of Culture Media for Food and Water Microbiology. Royal Society of Chemistry, In preparation. ICFMH-WPCM. Perez-Ortin JE, et al. Molecular characterization of a chromosomal rearrangement involved in the adaptive evolution of yeast strains. Genome Res. 12: 1533-1539, 2002. PubMed: 12368245 Ness F, et al. Identification of yeast strains using the polymerase chain reaction. J. Sci. Food Agric. 62: 89-94, 1993. |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |
