產品名稱 |
HFBCL09 |
商品貨號 |
B212366 |
Designations |
HFBCL09 |
GenBank Number |
M85629
|
Species |
Homo sapiens, human |
Applications |
The predicted product size is (bp): 127. The observed product size(s) is(are) (bp): 128 (human). |
Vector |
Construct size (kb): 4.5 DESCRIPTION OF VECTOR COMPONENT: Name of vector: pBluescript SK- Intact vector size: 2.960 Type of vector: phagemid Vector end: EcoRI Vector end: EcoRI Cloning sites: KpnI ApaI DraII XhoI (SalI HincII AccI) ClaI HindIII EcoRV EcoRI PstI SmaI BamHI SpeI XbaI EagI NotI SacII BstXI SacI Polylinker sites: SacI BstXI SacII NotI EagI XbaI SpeI BamHI SmaI PstI EcoRI EcoRV HindIII (ClaI Bsp106I) (HincII AccI SalI) XhoI (Eco0109I DraII ApaI) KpnI Construction: pUC19 Host range: Escherichia coli Features (with orientation and position when available): replicon: f1, -> insert detection: lacZ', <- primer site: M13-20, -> promoter: T7, -> MCS: KpnI...SacI, -> promoter: T3, <- promoter: lac, <- primer site: M13 reverse, <- replicon: pMB1 marker(s): ampR, <- Cross references: |
Insert |
DNA: cDNA DESCRIPTION OF INSERT COMPONENT: Genome: Homo sapiens Gene symbol: D10F117S1E Other gene symbols: D10S484E Gene name: DNA Segment, numerous copies, expressed Contains complete coding sequence?: U Sequence homology: Homo sapiens calbindin, 28 kDa Chromosome: 10; Localization: 10 Genome: Homo sapiens Gene symbol: D14F117S2E Gene name: DNA Segment, numerous copies, expressed Contains complete coding sequence?: U Chromosome: 14; Localization: 14 Tissue: fetal brain, female, 17-18 wk (Stratagene 936206) Type of DNA: cDNA Insert end: Modification: EcoRI linkers Insert end: Modification: EcoRI linkers Insert size (kb): 1.5 Cross references: DNA Seq. Acc.: M85629; EST: EST02146; Primer: M13 Forward; THC id: THC79399 DNA Seq. Acc.: T04987; EST: EST02875; Primer: M13 Reverse; THC id: THC111607 Insert lengths(kb): 1.5 Tissue: fetal brain, female, 17-18 wk (Stratagene 936206) Gene product: calbindin, 28 kDa [CALB] |
Insert Size (kb) |
1.5 |
Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Shipping Information |
Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--3.0, 1.5; PstI--3.1, 1.0, 0.5; HindIII--3.0, 1.5. EST02146 can be detected in genomic DNA using the following oligonucleotides (5'-3'): TCCTTGGGTAGAACTGCACT and GCTAATCCGTCCAGACTCAT. EST02146 matches GenBank accession RATCALBD28 with 87.79% identity over the sequence range: 146-227. This sequence record is for rat calbindin, 28 kDa (CALB). The predicted product size is (bp): 127. The observed product size(s) is(are) (bp): 128 (human). |
References |
Adams MD, et al. Sequence identification of 2,375 human brain genes. Nature 355: 632-634, 1992. PubMed: 1538749
Maglott DR, et al259 human brain expressed sequence tags (ESTs): chromosome localization, subregional assignment, and sequence analysisIn: Maglott DR, et alIdentification of transcribed sequencesNew YorkPlenum Presspp. 273-288, 1994
Adams MD, et al. 3400 expressed sequence tags identify diversity of transcripts from human brain. Nat. Genet. 4: 256-267, 1993. PubMed: 8358434
J C Venter, personal communication
|